پایان نامه درمورد پلیمراز، ميكروليتر، ، سانتريفيوژ، ميکروليتر، ميكروتيوب‌ها، نمونه‌ها، پرايمرها

ميكروتيوب‌ها 570 ميكروليتر از محلول TE (8=pH وmM tris-HCl10 ـ mM Na2EDTA1) اضافه ميگرديد و سپس تا حل شدن كامل رسوب عمل مخلوط شدن انجام ميشد.
3- سي ميكروليتر محلول SDS 10 درصد به نمونه‌ها اضافه شد.
4- چهار ميكروليتر از پروتئينازK (Fermentas , Germany, 20 mg/ml) اضافه ميشد.
5- شش ميکروليتر ليزوزيم (mg/ml30) با هدف هضم ديواره سلولي اضافه ميشد.
6- نمونه‌ها مخلوط شده و سپس حدود يك ساعت در بن ماري در دمايC° 37 قرار داده ميشدند.
7- بعد از خارج كردن ميكروتيوب‌ها از بن ماري، 100 ميكروليتر NaCl پنج مولار اضافه شده و سپس عمل مخلوط کردن انجام ميگرديد.
8- صد ميكروليتر از محلول CTAB/NaCl(M6/0 NaCl، 10%CTAB) اضافه ميشد، و عمل مخلوط کردن بعد از اضافه كردن محلول CTAB/NaCl تكرار ميشد.
9- ميكروتيوب‌ها حدود 12 دقيقه در بن ماري در دمايC °65 قرار داده ميشدند.
10- حدود 550 ميكروليتر از محلول كلروفرم/ ايزوآميل الكل به نمونه‌ها اضافه شده و نمونه‌ها بعد از عمل ورتکس حدود 7 دقيقه با دور 13000 سانتريفيوژ ميشدند.
11- بعد از سانتريفيوژ از مايع رويي ميكروتيوب‌ها حدود 550 ميكروليتر خارج شده و به ميكروتيوب‌هاي جديد منتقل ميشدند.
12- هم حجم مايع برداشت شده (حدود 550 ميكروليتر) از محلول فنل/ كلروفرم/ ايزوآميل الكل به ميكروتيوب جديد اضافه ميشد.
13- نمونه‌ها ورتکس شده تا رنگ محلول شيري شود، سپس حدود 7 دقيقه در 1300 دور سانتريفيوژ ميشدند.
14- بعد از سانتريفيوژ از مايع رويي نمونه‌ها (حدود 500 ميكروليتر) برداشت شده و به ميكروتيوب جديد منتقل ميگرديد.
15- به هر ميكروتيوب حدود 6/0 حجم مايع برداشت شده (حدود 300 ميكروليتر) ايزوپروپانول اضافه شده و ميكروتيوب‌ها تا ظاهر شدن رشته‌هاي سفيد رنگ DNA به آرامي تكان داده ميشدند.
16- سپس نمونه‌ها حدود 5 دقيقه با دور 10000 سانتريفيوژ ميشدند.
17- مايع رويي ميکروتيوب ها دور ريخته مي شد و سپس به ميکروتيوب ها حدود 100 ميکروليتر اتانول 70 درصد سرد اضافه شده و به آرامي مخلوط ميشد تا DNA آب دهي شود.
18- نمونه ها حدود 3 دقيقه با دور 10000 سانتريفيوژ ميشدند تا DNA رسوب داده شود.
19- با دقت محلول رويي ميكروتيوب‌ها دور ريخته شده و بعد از خشك كردن ميكروتيوب‌ها به آنها 50 ميكروليتر محلول TE اضافه شده و بعد از مخلوط کردن آرام در دمايC °20- تا هنگام انجام واکنش زنجیرهای پلیمراز نگهداري ميشدند (اصلاح شده احمدي و همکاران، 2010).
پرايمرها : براي تشخيص ژنهاي هموليزين هاياستافيلوکوکوس که شاملhld, hlb, hla و hlg هستند از پرايمرهاي تهيه شده توسط شرکت سيناژن استفاده شدكه رديف بازهاي آنها به شرح زير مي‌باشد (جاراد و همکاران، 2002)، (جد.ل 1-3):
جدول 1-3- چهار جفت پرايمر ژن هاي مولد هموليزين در استافيلوکوکوس
Toxin Target gene Primers Sequence (5′ 3′) Size of amplicons (bp) Anealing –perature(°C)
Alpha-hemolysinhla HLA-1 CTGATTACTATCCAAGAAATTCGATTG 209 58
HLA-2 CTTTCCAGCCTACTTTTTTATCAGT Beta-hemolysin hlb HLB-1 GTGCACTTACTGACAATAGTGC 309 58
HLB-2-2 GTTGATGAGTAGCTACCTTCAGT Delta-hemolysin hld HLD-1 AAGAATTTTTATCTTAATTAAGGAAGGAGTG 111 58
HLD-2 TTAGTGAATTTGTTCACTGTGTCGA Gamma-hemolysin hlg mpHLG-1 GTCAYAGAGTCCATAATGCATTTAA 535 58
components A, B, mpHLG-2 CACCAAATGTATAGCCTAAAGTG and C ب) آماده سازي پرايمرها (رقيق كردن پرايمرها): پرايمرها معمولاً به صورت استوک و با غلظت مشخصي ارائه مي‌شدند. بنابراين براي استفاده از آنها در واكنش زنجیرهای پلیمراز بايستي توسط آب مقطر غير يونيزه رقيق شوند. براي رقيق كردن بايستي OD پرايمر مشخص باشدكه اين اطلاعات معمولاً همراه پرايمر ارائه مي‌شود. در اين تحقيق از فرمول C1V1=C2V2 براي رقيق كردن پرايمرها استفاده و OD نهايي هر پرايمر برابر 5/0 محاسبه ميگرديد.
ج ) روش انجام واكنش زنجیرهای پلیمراز: واکنش زنجیرهای پلیمراز در يک حجم 25 ميکروليتري انجام ميگرفت که حاوي 2 ميکروليتر از DNA نمونه به دست آمده از کشت خالص بود. براي انجام واکنش زنجیرهای پلیمراز ابتدا مخلوط اصلي واکنش زنجیرهای پلیمراز تهيه ميشد. مخلوط اصلي به ازاي هر نمونه شامل 5/2 ميکروليتر بافر واکنش زنجیرهای پلیمراز 10X، 5/1 میکرولیتر MgCl2، 1 ميکروليتر dNTPs (Mμ50), 2/0 ميکروليتر Taq DNA polymerase (1U Ampli)، 1 ميکروليتر (pmol25) از پرايمرهايF و R بود و در نهايت حجم مخلوط با استفاده از آب دوبار تقطير به 25 ميکروليتر رسانده ميشد.
براي هر مرحله يك كنترل منفي و يك كنترل مثبت نيز تهيه ميشد. در كنترل منفي تمام تركيبات وجود داشت با اين تفاوت كه به جاي DNA از آب مقطر مخصوص واکنش زنجیرهای پلیمراز استفاده ‌ميگرديد. براي كنترل مثبت 5/12 ميكروليتر از مخلوط اصلي، 5/6 ميكروليتر آب مقطر غيريونيزه، 1 ميكروليتر از هر يك از پرايمرها و 2 ميكروليتر از كنترل مثبت حاوي DNA استافيلوکوکوس اضافه ‌ميشد. سپس ميكروتيوب‌هاي مخصوص واکنش زنجیرهای پلیمراز حدوداً 10 ثانيه سانتريفيوژ ‌ميشد تا قطرات محلول از ديواره‌لوله در ته لوله جمع شده و بعد به دستگاه واکنش زنجیرهای پلیمراز منتقل ‌ميشدند. برنامه حرارتي جهت تكثير ژنهاي هموليزين در دستگاه ترموسايكلر بدين صورت بود كه ابتدا براي 5 دقيقه DNA موجود در C ° 94 دناتوره شده و سپس 30 سيكل شامل 3 مرحله دناتوره شدن، اتصال پرايمرها و بسط به صورت زير انجام مي‌گرفت:
1- 45 ثانيه دناتوره کردن در دمايC ° 94
2- 45 ثانيه مرحله اتصال پرايمرها در دمايC ° 58
3- 70 ثانيه مرحله بسط در دمايC ° 37
و در نهايت پس از اتمام سيكل آخر، براي مدت 7 دقيقه عمل توسعه در دماي C °72 ادامه مي‌يافت تا عمل پليمرازيسيون تكميل گردد. سپس محصولات واکنش زنجیرهای پلیمراز به طور مختصر سانتريفيوژ شده تا مواد چسبيده به ديواره لوله در ته لوله جمع گردد و آماده الكتروفورز شود.
2- الكتروفورز محصولات واکنش زنجیرهای پلیمراز
ژل آگارز 2/1 درصد آماده مي‌شد و سپس محصولات واکنش زنجیرهای پلیمراز به ژل الكتروفورز به صورت زير منتقل مي‌شد.
الف) تهيه ژل آگارز 2/1 درصد
براي اين منظور 8/0 گرم از پودر آگارز وزن شده و سپس همراه با 80 ميلي ليتر بافر TAE یک برابر (1X) در درون ارلن ريخته مي‌شد، سوسپانسيون حاصله حرارت داده مي‌شد تا جايي كه مخلوط (آگارز-TAE) شفاف شود. بعد از اينكه محلول آگارز مقداري سرد شد، به ازاي هر ميلي ليتر ژل به ميزان 25/0 ميكروگرم (10 ميكروليتر) اتيديوم برومايد 10mg/ml اضافه مي‌شد و سپس دو طرف سيني ژل با نوار چسب شيشه‌اي بسته ميشد. شانه در محل خود قرار ميگرفت و ژل به داخل سيني ژل ريخته مي‌شد. بعد از 15 تا 20 دقيقه كه ژل سفت شد، چسب دو طرف سيني ژل برداشته شده و ژل همراه سيني داخل تانك الكتروفورز قرار مي‌گرفت. سپس از بافر 1X TAE (یک برابر) در داخل تانك ريخته مي‌شد تا حدود 3-2 ميلي متر بالاتر از سطح ژل قرار گيرد. سپس شانه برداشت شده و به اين ترتيب ژل براي بارگذاري نمونه‌هاي DNA استخراج شده آماده مي‌گرديد.
ب) انتقال محصولات واکنش زنجیرهای پلیمراز به ژل
هشت ميكروليتر از محصولات واکنش زنجیرهای پلیمراز به طور خالص با 2 ميكروليتر بافر بارگذار خوب مخلوط شده و سپس به آرامي داخل چاهك‌هاي ژل منتقل مي‌شد. به اين ترتيب كه در چاهك آخر ماركر100 bp (SMO 331) به ميزان 5 ميكروليتر و در چاهك ماقبل آخر كنترل مثبت و قبل از آن كنترل منفي قرار مي‌گرفت و براي حدود 60 دقيقه با شدت جريان V100 الكتروفورز انجام مي‌شد.
ج) رديابي محصولات واکنش زنجیرهای پلیمراز الكتروفورز شده
ژل به داخل دستگاه Trans illuminator (BTS-20, Japan) منتقل شده و با تابش اشعه ماوراء بنفش موقعيت قطعات DNA مشخص مي‌گرديد و با باندهاي موجود در ماركر 100bp (SMO 331) مقايسه و اندازه قطعات تكثير يافته تخمين زده مي‌شد.
نتايج
نمونههاي رشد يافته روي محيط آگار حاوي خون گوسفند پس از 24 ساعت گرمخانه گذاري در دمايC°37 بيرون آورده ميشد و پس از تهيه گسترش و رنگ آميزي گرم، کوکسي گرم مثبت خوشه انگوري در زير ميکروسکوپ مشاهده ميگرديد (شکل1-4). سپس تستهاي بيوشيميايي براي تاييد نهايي جنس استافيلوکوکوس انجام گرفت که در جداول 1-4، 2-4 و 3-4 به تفصيل شرح داده شده است (شکلهاي2-4، 3-4، 4-4، 5-4). پس از تاييد جنس باکتريهاي مورد مطالعه بر اساس تستهاي بيوشيميايي، نوع هموليز بر اساس ناحيه هموليز ايجاد شده توسط هر يک از جدايههاي مختلف روي محيط آگار حاوي خون گوسفند، خرگوش و اسب مشخص گرديد (جداول1-4، 2-4 و3-4 و شکلهاي 6-4، 7-4، 8-4). همچنين نتايج بررسي ژنوتيپي جدايههاي استافيلوکوکوس از نظر وجود يا عدم وجود ژنهاي مولد هموليزين با استفاده از عمل واکنش زنجیرهای پلیمراز در جداول و نمودارهاي 1-4، 2-4، 3-4، 4-4 و 5-4 آورده شده است. با توجه به اين که استافيلوکوکوس اورئوس قادر به تغيير رنگ محيط مانيتول سالت آگار از صورتي به زرد ميباشد و همچنين تست کوآگولاز آن مثبت است، لذا از بين 40 نمونه مورد مطالعه، 13 مورد استافيلوکوکوس اورئوس تشخيص داده شد. بيشترين نوع هموليزي که توسط اين سويه روي محيط کشت ايجاد شد، هموليز دوتايي (9 مورد، 69%) بود و هموليز بتا و دلتا هر کدام دو مورد مشاهده شد. هموليز آلفا و گاما توسط استافيلوکوکوس اورئوس توليد نشد. با بررسي ژنوتيپي

متن کامل در سایت homatez.com

About: admin