پایان نامه درمورد پلیمراز، میکرولیتر، ، سانتریفیوژ، میکرولیتر، میکروتیوب‌ها، نمونه‌ها، پرایمرها

میکروتیوب‌ها 570 میکرولیتر از محلول TE (8=pH وmM tris-HCl10 ـ mM Na2EDTA1) اضافه میگردید و سپس تا حل شدن کامل رسوب عمل مخلوط شدن انجام میشد.
3- سی میکرولیتر محلول SDS 10 درصد به نمونه‌ها اضافه شد.
4- چهار میکرولیتر از پروتئینازK (Fermentas , Germany, 20 mg/ml) اضافه میشد.
5- شش میکرولیتر لیزوزیم (mg/ml30) با هدف هضم دیواره سلولی اضافه میشد.
6- نمونه‌ها مخلوط شده و سپس حدود یک ساعت در بن ماری در دمایC° 37 قرار داده میشدند.
7- بعد از خارج کردن میکروتیوب‌ها از بن ماری، 100 میکرولیتر NaCl پنج مولار اضافه شده و سپس عمل مخلوط کردن انجام میگردید.
8- صد میکرولیتر از محلول CTAB/NaCl(M6/0 NaCl، 10%CTAB) اضافه میشد، و عمل مخلوط کردن بعد از اضافه کردن محلول CTAB/NaCl تکرار میشد.
9- میکروتیوب‌ها حدود 12 دقیقه در بن ماری در دمایC °65 قرار داده میشدند.
10- حدود 550 میکرولیتر از محلول کلروفرم/ ایزوآمیل الکل به نمونه‌ها اضافه شده و نمونه‌ها بعد از عمل ورتکس حدود 7 دقیقه با دور 13000 سانتریفیوژ میشدند.
11- بعد از سانتریفیوژ از مایع رویی میکروتیوب‌ها حدود 550 میکرولیتر خارج شده و به میکروتیوب‌های جدید منتقل میشدند.
12- هم حجم مایع برداشت شده (حدود 550 میکرولیتر) از محلول فنل/ کلروفرم/ ایزوآمیل الکل به میکروتیوب جدید اضافه میشد.
13- نمونه‌ها ورتکس شده تا رنگ محلول شیری شود، سپس حدود 7 دقیقه در 1300 دور سانتریفیوژ میشدند.
14- بعد از سانتریفیوژ از مایع رویی نمونه‌ها (حدود 500 میکرولیتر) برداشت شده و به میکروتیوب جدید منتقل میگردید.
15- به هر میکروتیوب حدود 6/0 حجم مایع برداشت شده (حدود 300 میکرولیتر) ایزوپروپانول اضافه شده و میکروتیوب‌ها تا ظاهر شدن رشته‌های سفید رنگ DNA به آرامی تکان داده میشدند.
16- سپس نمونه‌ها حدود 5 دقیقه با دور 10000 سانتریفیوژ میشدند.
17- مایع رویی میکروتیوب ها دور ریخته می شد و سپس به میکروتیوب ها حدود 100 میکرولیتر اتانول 70 درصد سرد اضافه شده و به آرامی مخلوط میشد تا DNA آب دهی شود.
18- نمونه ها حدود 3 دقیقه با دور 10000 سانتریفیوژ میشدند تا DNA رسوب داده شود.
19- با دقت محلول رویی میکروتیوب‌ها دور ریخته شده و بعد از خشک کردن میکروتیوب‌ها به آنها 50 میکرولیتر محلول TE اضافه شده و بعد از مخلوط کردن آرام در دمایC °20- تا هنگام انجام واکنش زنجیرهای پلیمراز نگهداری میشدند (اصلاح شده احمدی و همکاران، 2010).
پرایمرها : برای تشخیص ژنهای همولیزین هایاستافیلوکوکوس که شاملhld, hlb, hla و hlg هستند از پرایمرهای تهیه شده توسط شرکت سیناژن استفاده شدکه ردیف بازهای آنها به شرح زیر می‌باشد (جاراد و همکاران، 2002)، (جد.ل 1-3):
جدول 1-3- چهار جفت پرایمر ژن های مولد همولیزین در استافیلوکوکوس
Toxin Target gene Primers Sequence (5′ 3′) Size of amplicons (bp) Anealing –perature(°C)
Alpha-hemolysinhla HLA-1 CTGATTACTATCCAAGAAATTCGATTG 209 58
HLA-2 CTTTCCAGCCTACTTTTTTATCAGT Beta-hemolysin hlb HLB-1 GTGCACTTACTGACAATAGTGC 309 58
HLB-2-2 GTTGATGAGTAGCTACCTTCAGT Delta-hemolysin hld HLD-1 AAGAATTTTTATCTTAATTAAGGAAGGAGTG 111 58
HLD-2 TTAGTGAATTTGTTCACTGTGTCGA Gamma-hemolysin hlg mpHLG-1 GTCAYAGAGTCCATAATGCATTTAA 535 58
components A, B, mpHLG-2 CACCAAATGTATAGCCTAAAGTG and C ب) آماده سازی پرایمرها (رقیق کردن پرایمرها): پرایمرها معمولاً به صورت استوک و با غلظت مشخصی ارائه می‌شدند. بنابراین برای استفاده از آنها در واکنش زنجیرهای پلیمراز بایستی توسط آب مقطر غیر یونیزه رقیق شوند. برای رقیق کردن بایستی OD پرایمر مشخص باشدکه این اطلاعات معمولاً همراه پرایمر ارائه می‌شود. در این تحقیق از فرمول C1V1=C2V2 برای رقیق کردن پرایمرها استفاده و OD نهایی هر پرایمر برابر 5/0 محاسبه میگردید.
ج ) روش انجام واکنش زنجیرهای پلیمراز: واکنش زنجیرهای پلیمراز در یک حجم 25 میکرولیتری انجام میگرفت که حاوی 2 میکرولیتر از DNA نمونه به دست آمده از کشت خالص بود. برای انجام واکنش زنجیرهای پلیمراز ابتدا مخلوط اصلی واکنش زنجیرهای پلیمراز تهیه میشد. مخلوط اصلی به ازای هر نمونه شامل 5/2 میکرولیتر بافر واکنش زنجیرهای پلیمراز 10X، 5/1 میکرولیتر MgCl2، 1 میکرولیتر dNTPs (Mμ50), 2/0 میکرولیتر Taq DNA polymerase (1U Ampli)، 1 میکرولیتر (pmol25) از پرایمرهایF و R بود و در نهایت حجم مخلوط با استفاده از آب دوبار تقطیر به 25 میکرولیتر رسانده میشد.
برای هر مرحله یک کنترل منفی و یک کنترل مثبت نیز تهیه میشد. در کنترل منفی تمام ترکیبات وجود داشت با این تفاوت که به جای DNA از آب مقطر مخصوص واکنش زنجیرهای پلیمراز استفاده ‌میگردید. برای کنترل مثبت 5/12 میکرولیتر از مخلوط اصلی، 5/6 میکرولیتر آب مقطر غیریونیزه، 1 میکرولیتر از هر یک از پرایمرها و 2 میکرولیتر از کنترل مثبت حاوی DNA استافیلوکوکوس اضافه ‌میشد. سپس میکروتیوب‌های مخصوص واکنش زنجیرهای پلیمراز حدوداً 10 ثانیه سانتریفیوژ ‌میشد تا قطرات محلول از دیواره‌لوله در ته لوله جمع شده و بعد به دستگاه واکنش زنجیرهای پلیمراز منتقل ‌میشدند. برنامه حرارتی جهت تکثیر ژنهای همولیزین در دستگاه ترموسایکلر بدین صورت بود که ابتدا برای 5 دقیقه DNA موجود در C ° 94 دناتوره شده و سپس 30 سیکل شامل 3 مرحله دناتوره شدن، اتصال پرایمرها و بسط به صورت زیر انجام می‌گرفت:
1- 45 ثانیه دناتوره کردن در دمایC ° 94
2- 45 ثانیه مرحله اتصال پرایمرها در دمایC ° 58
3- 70 ثانیه مرحله بسط در دمایC ° 37
و در نهایت پس از اتمام سیکل آخر، برای مدت 7 دقیقه عمل توسعه در دمای C °72 ادامه می‌یافت تا عمل پلیمرازیسیون تکمیل گردد. سپس محصولات واکنش زنجیرهای پلیمراز به طور مختصر سانتریفیوژ شده تا مواد چسبیده به دیواره لوله در ته لوله جمع گردد و آماده الکتروفورز شود.
2- الکتروفورز محصولات واکنش زنجیرهای پلیمراز
ژل آگارز 2/1 درصد آماده می‌شد و سپس محصولات واکنش زنجیرهای پلیمراز به ژل الکتروفورز به صورت زیر منتقل می‌شد.
الف) تهیه ژل آگارز 2/1 درصد
برای این منظور 8/0 گرم از پودر آگارز وزن شده و سپس همراه با 80 میلی لیتر بافر TAE یک برابر (1X) در درون ارلن ریخته می‌شد، سوسپانسیون حاصله حرارت داده می‌شد تا جایی که مخلوط (آگارز-TAE) شفاف شود. بعد از اینکه محلول آگارز مقداری سرد شد، به ازای هر میلی لیتر ژل به میزان 25/0 میکروگرم (10 میکرولیتر) اتیدیوم بروماید 10mg/ml اضافه می‌شد و سپس دو طرف سینی ژل با نوار چسب شیشه‌ای بسته میشد. شانه در محل خود قرار میگرفت و ژل به داخل سینی ژل ریخته می‌شد. بعد از 15 تا 20 دقیقه که ژل سفت شد، چسب دو طرف سینی ژل برداشته شده و ژل همراه سینی داخل تانک الکتروفورز قرار می‌گرفت. سپس از بافر 1X TAE (یک برابر) در داخل تانک ریخته می‌شد تا حدود 3-2 میلی متر بالاتر از سطح ژل قرار گیرد. سپس شانه برداشت شده و به این ترتیب ژل برای بارگذاری نمونه‌های DNA استخراج شده آماده می‌گردید.
ب) انتقال محصولات واکنش زنجیرهای پلیمراز به ژل
هشت میکرولیتر از محصولات واکنش زنجیرهای پلیمراز به طور خالص با 2 میکرولیتر بافر بارگذار خوب مخلوط شده و سپس به آرامی داخل چاهک‌های ژل منتقل می‌شد. به این ترتیب که در چاهک آخر مارکر100 bp (SMO 331) به میزان 5 میکرولیتر و در چاهک ماقبل آخر کنترل مثبت و قبل از آن کنترل منفی قرار می‌گرفت و برای حدود 60 دقیقه با شدت جریان V100 الکتروفورز انجام می‌شد.
ج) ردیابی محصولات واکنش زنجیرهای پلیمراز الکتروفورز شده
ژل به داخل دستگاه Trans illuminator (BTS-20, Japan) منتقل شده و با تابش اشعه ماوراء بنفش موقعیت قطعات DNA مشخص می‌گردید و با باندهای موجود در مارکر 100bp (SMO 331) مقایسه و اندازه قطعات تکثیر یافته تخمین زده می‌شد.
نتایج
نمونههای رشد یافته روی محیط آگار حاوی خون گوسفند پس از 24 ساعت گرمخانه گذاری در دمایC°37 بیرون آورده میشد و پس از تهیه گسترش و رنگ آمیزی گرم، کوکسی گرم مثبت خوشه انگوری در زیر میکروسکوپ مشاهده میگردید (شکل1-4). سپس تستهای بیوشیمیایی برای تایید نهایی جنس استافیلوکوکوس انجام گرفت که در جداول 1-4، 2-4 و 3-4 به تفصیل شرح داده شده است (شکلهای2-4، 3-4، 4-4، 5-4). پس از تایید جنس باکتریهای مورد مطالعه بر اساس تستهای بیوشیمیایی، نوع همولیز بر اساس ناحیه همولیز ایجاد شده توسط هر یک از جدایههای مختلف روی محیط آگار حاوی خون گوسفند، خرگوش و اسب مشخص گردید (جداول1-4، 2-4 و3-4 و شکلهای 6-4، 7-4، 8-4). همچنین نتایج بررسی ژنوتیپی جدایههای استافیلوکوکوس از نظر وجود یا عدم وجود ژنهای مولد همولیزین با استفاده از عمل واکنش زنجیرهای پلیمراز در جداول و نمودارهای 1-4، 2-4، 3-4، 4-4 و 5-4 آورده شده است. با توجه به این که استافیلوکوکوس اورئوس قادر به تغییر رنگ محیط مانیتول سالت آگار از صورتی به زرد میباشد و همچنین تست کوآگولاز آن مثبت است، لذا از بین 40 نمونه مورد مطالعه، 13 مورد استافیلوکوکوس اورئوس تشخیص داده شد. بیشترین نوع همولیزی که توسط این سویه روی محیط کشت ایجاد شد، همولیز دوتایی (9 مورد، 69%) بود و همولیز بتا و دلتا هر کدام دو مورد مشاهده شد. همولیز آلفا و گاما توسط استافیلوکوکوس اورئوس تولید نشد. با بررسی ژنوتیپی

متن کامل در سایت homatez.com